Details for MX000091

General Information

MX000091

ArcA

B4401

Escherichia coli K-12 plasmid F DNA, complete sequence.

Escherichia coli str. K-12 substr. MG1655, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 14 1 2 3 43 39 11 20 35 26
T 29 3 48 47 3 6 31 25 9 21
G 6 47 0 2 4 2 1 2 4 2
C 3 1 2 0 2 5 9 5 4 3
Consensus W G T T A M W W W W

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098141 moeA operon
TTTTGCTATAAATAT
866523 866537 - 11357510
MF098304 acnA operon
TGTTATCAAA
1335739 1335748 + 9421904
MF098312 acnB operon
TTTAAATTTT
131342 131351 + 9421904
MF098313 ancB operon
TTTTGACTAATC
131348 131359 + 9421904
MF098314 ancB operon
TGCGAATTAA
131392 131401 + 9421904
MF098315 acnB operon
CGAATTAACGAA
131394 131405 + 9421904
MF098316 acnB operon
ACTTTTTTAT
131454 131463 + 9421904
MF098317 acnB operon
TGTTGCTTTT
131463 131472 + 9421904
MF098666 lpdA operon
TGTTAACAATTTTGTA
127691 127706 + 14711822
MF098673 aldA operon
TTGATGTTAATTAAC
1488173 1488187 + 10071223
MF098674 aldA operon
TAACAATGTATTCACC
1488184 1488199 + 10071223
MF098675 cydAB operon
ATAAGTTAACTAAATGTTA
770866 770884 + 8892825
MF098676 cydAB operon
GTGAGTTAATTATAATATA
770844 770862 + 8892825
MF098677 cydAB operon
TTTGAGTTTTTATTAACATGTTTGCAACCTTTCTT
771294 771328 + 10998176
MF098678 cydAB operon
CAGCCTTATAACTCACACATTTTAAACATAAATGTCACTAAAGTTACCTTATTGAAACATGATTAACATAATTTGT
771029 771104 + 8892825
MF098679 cydAB operon
ATATAATTATAAGTTA
770858 770873 + 8892825
MF098680 glcDFGB operon
TAACATTGAGTTAACC
3128167 3128182 - 14711822
MF098681 sdhCDAB operon
GGTTAATTGTAATGAT
754914 754929 + 8892825
MF098682 sdhCDAB operon
AATGATTTTGTGAACA
754924 754939 + 8892825
MF098683 icdA operon
TTACAAATCATTAACA
1195013 1195028 + 14711822
MF098684 lldPRD operon
TAACATTTAGTTAACC
3777266 3777281 + 8892825
MF098685 lpdA operon
TTAAAAATTGTTAACA
127683 127698 + 14711822
MF098686 focApflBA operon
TCCCTTTTAATTAACT
954676 954691 - 14711822
MF098687 focApflBA operon
TTTTAATTAACTGTTT
954672 954687 - 8892825
MF098688 sodA operon
TATCATTTAATTAACT
4100732 4100747 + 8412671
MF098689 aldA operon
AGTCGCTCGTTACGTTAAAAATTGCCCGTTTGTGAACCACTTGTTTGCAAACGGG
1488018 1488072 + 10071223
MF098693 gltA operon
CAATCATTCAACAAAG
754813 754828 - 8892825
MF098694 gltA operon
AGTTGTTACAAACATT
754799 754814 - 8892825
MF098695 focApflBA operon
GCTTAATGATTAGTCTGAGTTATATTACGGGGCGTTTTTTTAATG
954803 954847 - 7565118
MF098696 focApflBA operon
AATTATAAGGTTAAATATCGGTAATTTGTATTTAATAAATACGATCGATATTGTTACTTTATT
954702 954764 - 7565118
MF098697 focApflBA operon
TTTGGATAATCAAATATTTACTCCGTATTTGCATAAAAACCATGCGAGTTACGGGCCTATAAGCCAG
954548 954614 - 7565118
MF098698 focApflBA operon
GCTTTGTTAGTATCTCGTCGCCGAC
954487 954511 - 7565118
MF098701 sodA operon
CGCGGCATTAACAATC
4100767 4100782 + 8892825
MF098702 lldPRD operon
TTTAGTTAACCATTCA
3777271 3777286 + 8892825
MF098705 aceA operon
ATGAGTTAATTGATTT
4217030 4217045 + 8892825
MF098706 appY operon
TTTTGTTAATTGAATG
583301 583316 + 8892825
MF098707 appY operon
TTATGTTAATAAAAAG
583451 583466 + 8892825
MF098708 arcA operon
agttgttaaaaaatgc
4638340 4638355 - 8892825
MF098709 betIBA operon
taatagataaacaccg
328580 328595 - 8892825
MF098710 betT operon
AATTGTTACGAATTTG
329412 329427 + 8892825
MF098711 cyoABCDE operon
atttgttaaataattg
451073 451088 - 8892825
MF098712 dadAX operon
GCATGTTGAATAATAT
1237485 1237500 + 8892825
MF098713 fadBA operon
catatttttaacacaa
4028621 4028636 - 8892825
MF098714 nuoABCEFGHIJKLMN operon
tggtgttgatattatg
2403286 2403301 - 8892825
MF098715 mdh operon
cttagtttatcaatat
3381919 3381934 - 8892825
MF098716 traY operon
NA
67741 67756 + 8892825
MF098717 hyaABCDEF operon
CCATTTTTATCGC
1031910 1031922 + 10537212
MF098720 hybOABCDEFG operon
TTTAATTAATTACACT
3146412 3146427 - 10537212
MF098724 dcuC operon
AGTTAAATAT
656422 656431 - 10368146
MF098729 glcDFGB operon
CTTAATAACT
3128083 3128092 - 9880556
MF100669 sodA operon
8412671