Details for MX000092

General Information

MX000092

CaiF

b0034

Escherichia coli str. K-12 substr. MG1655, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 1 0 0 0 0 0 2 2 0 2 0 0 0 0 0 0 2 0 0 1 2 0 1 1 2 2 0 2 2 0 2 0 0 0 2 2 2 1 0 0 0 0 1 0 0
T 1 0 1 2 2 2 0 0 0 2 0 2 2 0 0 2 0 0 1 0 0 0 1 1 1 0 0 0 0 0 2 0 2 2 0 0 0 0 0 2 2 1 0 1 2 2
G 1 1 0 0 0 0 0 0 0 0 0 0 0 2 2 0 2 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 1 0 0 1 1 0 0 0
C 0 0 1 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
Consensus K R Y T T T C A A T A T T G G T G A K S M A Y W W A A C A A T A T T G A A A R T T K S W T T

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098156 caiTABCDE/fixABCX operon
GACTTTCAATATTGGTGATCCATAAAACAATATTGAAAATTTCTTTTTGCTACG
42178 42231 + 10564497
MF098157 caiTABCDE/fixABCX operon
TGTTTTCAATATTGGTGAGGAACTTAACAATATTGAAAGTTGGATT
42235 42280 + 10564497