Details for MX000093

General Information

MX000093

Crp (20mer)

b3357

Escherichia coli str. K-12 substr. MG1655, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 96 74 31 21 15 18 166 49 55 50 72 49 81 15 29 160 44 120 64 77
T 86 88 137 34 162 25 10 91 43 87 52 47 55 161 20 17 27 34 76 107
G 23 30 15 150 5 166 14 33 41 38 45 67 39 11 5 28 6 33 29 4
C 5 18 27 5 28 1 20 37 71 35 41 47 35 23 156 5 133 23 41 22
Consensus W N N R T G A N N N N N N T M A M N N W

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098065 glpD operon
taatgttatacatatcactcta
3559530 3559551 + 3045087
MF098070 glpFK operon
tTtTATGAcgaggcACACAcAt
4118211 4118232 - 1372899
MF098071 glpFK operon
TTAAGTTCGATATTTCTCGTTT
4118188 4118209 - 1372899
MF098078 glpACB operon
AATATGCGCGAAATCAAACA
2352573 2352592 + 9179845
MF098081 glpTQ operon
TAATGTGTGCGGCAATTCACATTTAA
2352480 2352505 - 1556120
MF098147 lacZYA operon
AATGTGAGTTAGCTCACTCAT
366394 366414 - 2166165
MF098154 caiTABCDE operon
AATGTGATACCAATCACAGA
42069 42088 - 10564497
MF098155 caiTABCDE/fixABCX operon
ATTGTTTTATGGATCACCAA
42189 42208 - 10564497
MF098156 caiTABCDE/fixABCX operon
GACTTTCAATATTGGTGATCCATAAAACAATATTGAAAATTTCTTTTTGCTACG
42178 42231 + 10564497
MF098157 caiTABCDE/fixABCX operon
TGTTTTCAATATTGGTGAGGAACTTAACAATATTGAAAGTTGGATT
42235 42280 + 10564497
MF098158 fixABCX operon
TTGGTGAGGAACTTAACAAT
42246 42265 + 10564497
MF098177 hpt + gcd operon
ATGTGTGATCGTCATCACAATT
141284 141305 + 11810262
MF098267 proP operon
ATGTGTGAAGTTGATCACAAATT
4330275 4330297 + 10894725
MF098268 proP operon
ATTGTACATTCCTTAACCGGA
4330356 4330376 + 10894725
MF098270 bglGFB operon
aactgcgagcatggtcatattt
3904376 3904397 - 10760165
MF098303 aldB operon
ttgcccgtaaattcgtgatagctgtcgtaaagct
3754212 3754245 - 7768815
MF098308 acnA operon
ATTTGGGTTGTTATCAAATC
1335731 1335750 + 9421904
MF098318 acnB operon
TTTGTAAACAGATTAACACC
131472 131491 + 9421904
MF098324 ptsG operon
TGAAACGTGATAGCCGTCAAACA
1157713 1157735 + 12588863
MF098325 ptsG operon
TATTGTGACATATGTTTTGTC
1157661 1157681 + 12588863
MF098334 yheBA operon
tttgcagtttttacgtcacaagg
3467498 3467520 - 10760150
MF098335 crp operon
TATGCAAAGGACGTCACATT
3485985 3486004 + 9582281
MF098336 crp operon
GAAGGCGACCTGGGTCATGCT
3485882 3485902 + 9582281
MF098351 guaBA operon
ACATGTGAGCGAGATCAAATTCT
2634213 2634235 - 8828209
MF098360 hupA operon
GAAAACGTGATTTAACGCCTGATTTGT
4200100 4200126 + 8913296
MF098364 hupB operon
AATAGTGACCTCGCGCAAAATGCACT
461238 461263 + 8913296
MF098669 araBAD operon
ACATTGATTATTTGCACGGCGTCACACTTTGCTAT
70152 70186 - 6262769
MF098670 araFGH operon
CTGCGATGTGATATTGCTCTCCTATGG
1986268 1986294 - 2231717
MF098671 araJ operon
CAAACTGGAAAGTACGTTTGCAGTGAAATAACT
412605 412637 - 2231717
MF098672 araJ operon
CGTTCTGGTGGTTGTGATGGTGG
412483 412505 - 2231717
MF098690 aldA operon
TTGTTTTTATGAAGCCCTTCACAGAATT
1488116 1488143 + 10071223
MF098691 sdhCDAB operon
TATCGTGACCTGGATCACTGTT
754864 754885 + 9302022
MF098740 astCADBE operon
AATTTCGTCAATGATCACAATT
1832234 1832255 - 12003934
MF098794 cytR operon
tcgaaaaattcaatattcatcacacttttca
4122139 4122169 - 1328649
MF098795 udp operon
TATGTGATTTGCATCACTTT
4016288 4016307 + 10347150
MF098796 udp operon
ATGGTGATGAGTATCACGAA
4016340 4016359 + 10347150
MF098802 deoCABD operon
TCCTTAATTGTGATGTGTATCGAAGTGT
4617222 4617249 + 8394345
MF098803 deoCABD operon
GAATTATTTGAACCAGATCGCATTACAG
4617171 4617198 + 8394345
MF098811 rpoH operon
CTTGTGGATAAAATCACGGT
3600881 3600900 - 2139650
MF098866 ptsH operon
TTTGTGGCCTGCTTCAAACTT
2533428 2533448 + 7852310
MF098867 ptsH operon
TTTATGATTTGGTTCAATTCTT
2533556 2533577 + 7852310
MF098942 galS operon
GCTGTGACTCGATTCACGAA
2241743 2241762 - 8416900
MF098943 galR operon
AATGTAAGCGTTTACCCACT
2976568 2976587 + 8416900
MF098947 gadA operon
CTTAGGATTTTGTTATTTAAA
3667660 3667680 - 11238978
MF098949 gadBxasA operon
ATTAGGATTTTGTTATTTAAA
1572125 1572145 - 11238978
MF098981 gntT operon
TAATATGACCAACCTCTCATAA
3546323 3546344 + 9358057
MF098982 gntT operon
AGATGTTACCCGTATCATTCAC
3546381 3546402 + 9045817
MF098995 rpoSnlpD operon
ACTGCGACCACGGTCACAGC
2868053 2868072 - 8208244
MF099006 laczYA operon
GTGGAATTGTGAGCGGATAACAATTTCACACA
366316 366347 - 2166165
MF099024 dadAX operon
GATGTGATTAGATTATTATTCTTTT
1237519 1237543 + 9648752
MF099025 dadAX operon
GAGATGTGAGCCAGCTCACCATA
1237454 1237476 + 9648752
MF099032 serA operon
AAAAAAATTCTCTTCATTAAATTT
3058618 3058641 - 11985712
MF099049 osmY operon
ATTTAACAAAGTGATGACATTT
4611143 4611164 + 8253679
MF099052 serCaroA operon
TTGTGTGATGCAAGCCACATTT
957498 957519 + 9171388
MF099096 malEFG + malKlamBmalM operon
TGTGTGATCTCTGTTACAGA
4246531 4246550 +/- 1824723
MF099097 malEFG + malKlamBmalM operon
AATGTGGAGATGCGCACATA
4246560 4246579 +/- 1824723
MF099098 malEFG + malKlamBmalM operon
TTTGCAAGCAACATCACGAA
4246594 4246613 +/- 1824723
MF099099 malEFG + malKlamBmalM operon
ACCTCGGTTTAGTTCACAGA
4246626 4246645 +/- 1824723
MF099151 acrE- operon
AATCGTTAAATAAATAATATAT
3413575 3413596 + 15520470
MF099152 adhE operon
AAATTTGATTTGGATCACGTAA
1298341 1298362 - 15520470
MF099153 arcA operon
GAACTTGATATATGTCAACGAA
4640580 4640601 - 15520470
MF099154 arcA operon
TAATGTGACGAAAGCTAGCATT
4640643 4640664 - 15520470
MF099155 argR operon
TAATGTTGTATCAACCACCATA
3384670 3384691 + 15520470
MF099156 argR operon
CAATTTGATAACAATTAATTTA
3384510 3384531 + 15520470
MF099157 b1329 operon
TATATTGATACTTAAAACATTT
1393105 1393126 + 15520470
MF099158 b1329 operon
TTCTTTAAGGCGAAACAAATAA
1393168 1393189 + 15520470
MF099159 b2085_b2084_b2083
TATTATAATCCTATTCAATTAT
2168374 2168395 - 15520470
MF099160 yffQ operon
TTTTGTGATGCAGATCGCTTTT
2563421 2563442 + 17608696
MF099161 b2450 operon
TTTTGTGATCTGCGTCAATATT
2564424 2564445 + 15520470
MF099162 b2450 operon
CAATGAAACTGAGTTCAAACTT
2564264 2564285 + 15520470
MF099163 b2462_b2461_b2459_eutI_cchA operon
CTTAGTGATCTACCTCACCTTT
2575887 2575908 - 15520470
MF099164 b2463 operon
ATGAGTGCGTTAATTCACACTT
2578613 2578634 - 15520470
MF099165 b2710_ygbD promoter
TAGAGTAAAAACAATCAGATAA
2832386 2832407 + 15520470
MF099166 b2736_b2737 promoter
TTATGTGAATCAGATCACCATA
2861340 2861361 + 15520470
MF099167 b2736_b2737 operon
TTATATTCACAATATCAAACAA
2861379 2861400 + 15520470
MF099169 b2876_b2875 operon
GATATTGCTCTGGTTCGCATAA
3015339 3015360 - 15520470
MF099171 hybO_ hybABCDEF operon
TATCATGATATCGATAACCATA
3146354 3146375 - 15520470
MF099172 hybO_hybABCDEF operon
TTTTGCGATTGAGGCAAAATAT
3146293 3146314 - 15520470
MF099174 b3001 operon
ATACGTGATGTACTCAGCAACA
3147518 3147539 + 15520470
MF099179 chb operon
TGTGAAGAGGGTCATA
1821802 1821817 - 18028317
MF099183 csgDEFG operon
TTTAGTTACATGTTTAACACTT
1103376 1103397 - 15520470
MF099184 csgDEFG operon
AGGTGTGCGATCAATAAAAAAA
1103210 1103231 - 15520470
MF099185 csgDEFG operon
TTATTAGTAAGTTATCACCATT
1103504 1103525 - 15520470
MF099186 cyoABCDE operon
ATAATTGTTTTATTTCACATTG
451834 451855 - 15520470
MF099187 cyoABCDE operon
GAATTTAATCATGTTTACAGTA
451680 451701 - 15520470
MF099188 exuT operon
ATTTGTGATGGCTCTCACCTTT
3244952 3244973 + 15520470
MF099189 exuT operon
TTTCGTGAGTTAGATCAATAAA
3244830 3244851 + 15520470
MF099190 fadD operon
AATAGTGACGCGCTTCGCAACC
1889856 1889877 - 15520470
MF099192 gatYZA operon
TTTTGTGATCGTTATCTCGATA
2177264 2177285 - 17608696
MF099193 hydHG operon
TTTCGTGTTCCGTTTCATGGTT
4201671 4201692 + 15520470
MF099194 fucAO+fucPI operon
TTATGTGACTACCATCACTTTA
2934028 2934049 +/- 15520470
MF099195 fucAO operon
TTAGTTGAACCAGGTCACAAAA
2933811 2933832 - 15520470
MF099196 uxaB operon
AACCATGATCCGCGCCACACTT
1610804 1610825 + 15520470
MF099197 fucPI operon
AAGTGTGACCGCCGTCATATTA
2934068 2934089 + 15520470
MF099198 fumA operon
GTGAGAGAACAATGTCAAACAA
1688367 1688388 - 15520470
MF099201 grpE operon
GAGCGTGCCAGTTTTCACATTC
2750980 2751001 - 15520470
MF099208 gntP operon
GGATGTGACATTCATCGCAACA
4551365 4551386 - 15520470
MF099209 gntP operon
AATGGTTGACCAATTTACATAA
4551344 4551365 - 15520470
MF099210 hrsA_ybgG operon
TCAAGTGAAATTGATCACATAA
765963 765984 + 15520470
MF099211 hrsA_ybgG operon
TTCTTTGACGTAAGTCCCGCTG
765663 765684 + 15520470
MF099212 kdgT operon
TTTTGTGATCAATTTCAAAATA
4101510 4101531 + 15520470
MF099213 kdgT operon
TGATGTGGTTTTGATCACTTTT
4101570 4101591 + 15520470
MF099214 marRAB operon
AAACGTGGCATCGGTCAATTCA
1619030 1619051 + 15520470
MF099215 marRAB operon
TAATGTGAAAAGTACCAGCGAT
1619116 1619137 + 15520470
MF099216 modABC operon
TTTTCTTATCTACCTCACAAAG
794989 795010 + 15520470
MF099217 ndk operon
GACAGTGAAATTTGTCATGCAA
2645016 2645037 - 15520470
MF099218 nrdAB + yfaE operon
AACAGTTATTTTTAACAAATTT
2344608 2344629 + 15520470
MF099219 rpiR_yjcXWVUTS operon
ATTTGTGATGTTAATGAATTAA
4313288 4313309 - 15520470
MF099220 rpiR_yjcXWVUTS operon
TTTTGTGAAGTCGCCAGCATCT
4313050 4313071 - 15520470
MF099221 rpiR_yjcXWVUTS operon
AAATTTTAAGCCACTCGCCATT
4313106 4313127 - 15520470
MF099222 sbmC operon
GAGTGCGAGTCTGCTCGCATAA
2081334 2081355 - 15520470
MF099223 sdaC_sdaB_exo operon
ATTTGAGATCAAGATCACTGAT
2928050 2928071 + 17608696
MF099224 rhaT + sodA operon
GTGGGTGATTTGCTTCACATCT
4100649 4100670 +/- 8757746
MF099225 speAB operon
AGTCGTTAACTGTTTTACACTT
3085935 3085956 - 15520470
MF099226 speF_potE operon
AGAGATGAAAAATGTCAAAATT
720450 720471 - 15520470
MF099227 srlAEBD_gutM_srlR_gutQ operon
TTTTGCGATCAAAATAACACTT
2825739 2825760 + 15520470
MF099228 srlAEBD_gutM_srlR_gutQ operon
CATTGTGCTGCGGCTCAAGCAG
2825438 2825459 + 15520470
MF099229 ucpA operon
AACGGTGATTGCCATTACTTCT
2544959 2544980 - 15520470
MF099230 ucpA operon
ATTAGTGAGCTGATCCGCAGCA
2544695 2544716 - 15520470
MF099231 wzzB operon
TTTTGTTACTTACACAACAATT
2098389 2098410 - 15520470
MF099232 yaaF operon
ATTCGTGAAGTCGATTAAGTCA
27210 27231 + 15520470
MF099233 ybbB operon
TATTGTGACCTTGTTTACCCAG
531349 531370 - 15520470
MF099235 ybiP operon
ATTTGCAATCCCCTTCGCAAAA
852766 852787 - 15520470
MF099236 ybiH_b0795_ybhFSR operon
TTTTGTGACGCAGCGCATAAAT
830745 830766 - 15520470
MF099239 yadN operon
AATTTTGAATTAAGTAAATTTA
157060 157081 - 15520470
MF099243 yahM operon
TGTTGTGATCGGCGACACTTCG
345114 345135 + 15520470
MF099244 yahO operon
GGGTGCGAGAGAGATCACAAAG
346357 346378 + 15520470
MF099245 yahO operon
CATAGTGATTTCATCCATAAAT
346296 346317 + 15520470
MF099246 yaiB_ phoA operon
AGATGTGCGCAAGATCACAAAA
401063 401084 + 15520470
MF099247 yaiB_phoA operon
TAATGTTAACTTCTCCATACTT
401345 401366 + 15520470
MF099248 yaiB_phoA operon
GAAAGTGCGTTATCTCAAAGAT
401045 401066 + 15520470
MF099249 ybiP operon
TTGTGCGATATGGTCAACAACA
852901 852922 - 15520470
MF099250 ybiP operon
TGGTCTGAAAAACCCCACTTTT
852794 852815 - 15520470
MF099251 ycdZ operon
AAGTGTGATCTACGTCACTCAT
1100193 1100214 + 17608696
MF099252 ycdZ operon
AAATGTGTGCTCGATCTCATTC
1100244 1100265 + 15520470
MF099253 ychH operon
AATTGTGATCACGCCCGCACAT
1258686 1258707 + 17608696
MF099254 ydcH operon
AAACACGATCCCGCTCGCATTT
1498555 1498576 + 15520470
MF099255 yeaA_b1777 operon
AAATGTGATTTTCATCACGATT
1862545 1862566 - 15520470
MF099256 yeaA_b1777 operon
TAATGTGAGCACGATTAAAGTG
1862442 1862463 - 15520470
MF099257 yedEF operon
AAATTTGATCTAACTATTATTT
2008168 2008189 + 15520470
MF099258 yedEF operon
AATTGCGAGTTTTTTCATCATT
2008073 2008094 + 15520470
MF099259 yedL operon
CTATTAGACAAAGATTTCATTA
2010536 2010557 + 15520470
MF099260 yeeA operon
ATGAGCGCTTTTAATCTCATTA
2080604 2080625 - 15520470
MF099261 yeeA operon
TTATTTGAACAATGGCGCGGAA
2080843 2080864 - 15520470
MF099262 yejK operon
ATTTGTGGCATAAATCGAAATC
2284118 2284139 - 15520470
MF099263 yejK operon
ATGCGTTAAATCATTCTCGTTA
2284038 2284059 - 15520470
MF099264 yfaD operon
AAAAGAGAACTACCCCACCTCA
2356537 2356558 + 15520470
MF099265 yfaO operon
AAAAGAGATTACTGTCACTTTC
2364474 2364495 + 15520470
MF099266 yfeCD operon
AGTAGTTATTCATGTCACGGTT
2518368 2518389 + 15520470
MF099267 ygbLM operon
TATCATGAGCGATTTCGCAAAA
2863589 2863610 + 15520470
MF099268 ygbLM operon
AACAGCAATACGGTGCACAAAA
2863308 2863329 + 15520470
MF099269 ygcB operon
ATTTATGAGCAGCATCGAAAAA
2887268 2887289 - 15520470
MF099270 ygjU operon
AAATATGACCTCTCTTTAAAAT
3239792 3239813 + 15520470
MF099271 yhaB_yhaC operon
TTTTGTGTTGAGGATCACAAAA
3267630 3267651 + 15520470
MF099272 yhdG_fis operon
AAGTGCGAGCAAGCTCACAAAA
3409983 3410004 + 15520470
MF099273 yhdG_fis operon
AATTGAGAACTTACTCAAATTT
3410068 3410089 + 15520470
MF099274 yhdJ operon
CTTTTTTATAGGTGTCACAAAG
3411622 3411643 (null) 15520470
MF099275 yhdU operon
GAAGTTGACCCCGATCTCATTA
3412508 3412529 + 15520470
MF099276 yhfMNO operon
TTTTGTGATCTTCCTCCACATT
3499784 3499805 + 15520470
MF099277 yhfMNO operon
TGTTGTTATATTCATCATGCAT
3499819 3499840 + 15520470
MF099278 yhfPQR operon
AAAAGCGGGCGGCATCAAACAA
3502471 3502492 + 15520470
MF099279 yhfZY operon
AAATGTGAAGTGCCTCGCCGTT
3512417 3512438 - 15520470
MF099280 yhiP operon
AACATTTAACACCATCATATTT
3640682 3640703 + 15520470
MF099281 yi81_1 operon
TAAAGTGGCGGGGATCACTCCC
15369 15390 + 15520470
MF099282 yidE operon
ATGTGCGCTATAAGGCAAATCT
3866334 3866355 - 15520470
MF099283 yidP operon
ATTCGTGATCGCTTTCATGCTT
3863714 3863735 + 15520470
MF099302 yidW_b3694_dgoKA operon
TTTTGTGATCTAAATTGTAGTA
3875293 3875314 - 15520470
MF099303 yidW_b3694_dgoKA operon
AAACGCGAACGTCATCACGCTG
3875235 3875256 - 15520470
MF099304 yiePO operon
TTTTGCAACCGTAATCACACTT
3941375 3941396 - 15520470
MF099306 yiePO promoter
TAATGTGCCATAAAACAAGCAA
3941405 3941426 - 15520470
MF099307 yihVWX_rbn_yihZ_yiiD operon
AAAATTGACAGCCGTCACTTTT
4073663 4073684 + 15520470
MF099308 yjeM operon
ATATTTGATATCATCCAGGTAT
4383722 4383743 + 15520470
MF099309 yjeNO operon
ATTTGCGAACGTCTTCACCATC
4385176 4385197 + 15520470
MF099310 yjeNO promoter
GTTTGTGATTTTCAAAACGCAT
4385110 4385131 + 15520470
MF099311 yjfG operon
AAATGAGCGGCAGATTAAAAAA
4455751 4455772 + 15520470
MF099312 yjhBC operon
TAGAGTGAAATATGTTAAGAAG
4503889 4503910 + 15520470
MF099313 yjiMLKJ operon
AACCGCGAGAGAGATCAAATAA
4565920 4565941 - 15520470
MF099315 yjjM operon
TTTTGTGAAAACACACGCATAA
4595896 4595917 - 15520470
MF099316 ynfM operon
TTATTTGAGATTATTAATATAT
1669605 1669626 + 15520470
MF099318 yqiEB_icc_yqiA_parE operon
AACGTCGCTGAAATTCACATTT
3177940 3177961 - 15520470
MF099321 ytfQ operon
AAGTGTGATGTAACGCAATCTG
4449864 4449885 + 15520470
MF099325 zipA operon
AGATGTGAATGATGAAACCATA
2531462 2531483 - 15520470
MF099366 melAB operon
ACTGCGAGTGGGAGCACGGT
4341682 4341701 + 10760178
MF099371 manXYZ operon
TTACGGATCTTCATCACATA
1901883 1901902 + 9484892
MF099375 mhpABCDFE operon
TTCTGCATATTAATTGACATTT
368413 368434 + 12748194
MF099386 nagABCD operon
TTTTGTGAGTTTTGTCACCAAA
703768 703789 - 1848637
MF099387 nagE operon
aaatttaattcgtatcgcaaat
703025 703046 + 1848637
MF099433 pdhR operon
GTTGTTAAAATGTGCACAGT
121954 121973 + 8057842
MF099503 rhaBAD + rhaSR operon
attgtgaacatcatcacgtt
4095136 4095155 +/- 8230210
MF099504 rhaSR operon
GATGTGATGCTCACCGCATT
4097590 4097609 + 11073923
MF099505 rhaSR operon
TTCCTGAAAATTCACGCTGT
4097609 4097628 + 11073923
MF099506 rhaSR operon
GTGGTGATGTGATGCTCACC
4097585 4097604 + 11073923
MF099507 flhDC operon
TGTGTGATCTGCATCACGCA
1978457 1978476 - 10601207
MF099510 hlyE operon
TTGTTTGATATTTATCATATTA
1230517 1230538 - 11053378
MF099528 treBC operon
AATTGTGATCTTCGCTGCGTTTC
4466259 4466281 - 9148912
MF099530 treBC operon
AAATGTCATCTGCCATGGGG
4466185 4466204 - 7608078
MF099544 xylAB operon
TGCGAGCGAGCGCACACTTG
3730877 3730896 - 9371449
MF100131 ydeI operon
15520470
MF100214 ydeI operon
15520470
MF100243 yedN_b1933 operon
15520470
MF100343 yedM operon
15520470
MF100348 b1513_ydeYZ_b1516_ yneB operon
15520470
MF100353 yigC operon
15520470
MF100363 fucAO operon
15520470
MF100422 b0846 operon
15520470
MF100463 b2448_b2449 operon
15520470
MF100608 yedN_b1933 operon
15520470
MF100649 yabQ operon
15520470
MF100651 yabQ operon
15520470