Details for MX000094

General Information

MX000094

CysB

B1275

Escherichia coli str. K-12 substr. MG1655, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 3 2 4 2 1 0 5 0 7 1 2 1 4 4 5 5 2 2 2 2 4 5 1 0 2 5 3 1 4 6 1
T 3 5 3 4 2 0 3 9 2 8 2 1 2 3 2 1 3 1 3 4 5 4 5 5 2 1 3 5 3 2 5
G 2 2 2 3 3 8 1 0 0 0 4 5 1 1 1 2 1 1 2 0 0 0 1 2 1 0 2 2 0 0 3
C 1 0 0 0 3 1 0 0 0 0 1 2 2 1 1 1 3 5 2 3 0 0 2 2 4 3 1 1 2 1 0
Consensus N D D D N G W T A T N N N N N N N N N H W W N B N M N N H W K

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098159 tauABCD operon
TTAGAACGGAGTAATTGCATATTTAATCTTTCCTTAGCCGTTTTTTTGCTAAGAATAAAATCATCTGTGCGATAACGACTAATTCTTTTAATGAATGTTTTTATTCCTGA
385085 385194 + 9401024
MF098160 tauABCD operon
TTATTATATGTATTGATATTGATAGAAATAATGAAGTAAT
384984 385023 + 9401024
MF098792 cysDNC operon
ttaagcactttttgatattagctttgccaaatcgttattccgttaag
2874453 2874499 - 1316900
MF098853 cysPU operon
CTTCCAAATCACCAAACGGTATATAAAACCGTTACTCCTTTCACGTCCGTTATAAATAT
2543569 2543627 - 15255893
MF098854 cysPU operon
CTTATTCCCTTTTCAACTTCCAAATCACCAAACGGTATATA
2543603 2543643 - 15255893
MF098855 cysK operon
CATGTCATTATTTCCCTTCTGTATATAGATATGCTAAATCCTTACTTCCGCAT
2532297 2532349 + 2254265
MF098856 cysK operon
GAAACAGGGGTGGCTTATGCCGCCCCTTATTCCATCTTGCAT
2532258 2532299 + 2254265
MF098857 cysJIH operon
AAACAGGTTAGTCGATTTGGTTATTAGTTATCGCTATCCCGTCTTTAATCCA
2891991 2892042 - 2254265
MF098858 cysB operon
TAGTGGTTATAGTTAGCACCTTTTTTATTATTAAATCGTATTAGTC
1333751 1333796 + 1706701