Details for MX000096

General Information

MX000096

Lrp

b0889

Escherichia coli str. K-12 substr. MG1655, complete genome.

Helicobacter pylori 26695 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 8 14 7 8 14 13 6 3 3 30 3 4 4 4
T 12 8 7 14 10 13 25 33 33 4 31 24 6 21
G 4 10 19 9 8 8 4 0 1 1 2 4 4 6
C 14 6 5 7 6 4 3 2 1 3 2 6 24 7
Consensus N N N N N N W T T A T N N N

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098173 osmY operon
GCTTACGGAATGTTCTTAAAACATTCACTTTTGCTTATGTTTTCGCTGATATCCCGAGCGGTTTCAAAATTGTGATCTATATTTAACAAAG
4611063 4611153 + 10856246
MF098179 gltBDF operon
TGACAGTCAGGAATTGACTGTTT
3354346 3354368 + 11395454
MF098181 yeiL operon
CAGAATAATTTTTCT
2255163 2255177 + 11101674
MF099029 osmC operon
GCCGGATTTTATTCGG
1556536 1556551 + 9663683
MF099033 serA operon
ATGTGTCACGCTTTTACCAGGCAATTGTCGATTGCTCTAAATAAATCCTCTAAACCAGCATATTCATCCAAGAAT
3058537 3058611 (null) 11985712
MF099046 osmY operon
AGGAACGTTATCCG
4610957 4610970 + 8253679
MF099047 osmY operon
CGAGCATTAATTCT
4610994 4611007 + 8253679
MF099050 lrp operon
GATTAAATGATGAATAAACGCCCCTGTTAATGAATATCTGGCATGTTGTACTAAAAATCGATGTTTTGCTTTGACAATCCCCTGGT
932223 932308 + 8144448
MF099051 serCaroA operon
CAGTAAAAACATCGG
957455 957469 + 9171388
MF099060 stpA operon
TAGCGTATATCGCTG
2799068 2799082 - 8890170
MF099061 stpA operon
TAGTCAGTTTTTGTA
2799019 2799033 - 8890170
MF099062 stpA operon
CTTGAAATTATTCTG
2798636 2798650 - 8890170
MF099074 dadAX operon
GAGAATTTTTTTCTT
1237325 1237339 + 8955407
MF099075 dadAX operon
CGGAATTTTATGCTG
1237382 1237396 + 8955407
MF099076 dadAX operon
TAGATTATTATTCTT
1237527 1237541 + 8955407
MF099077 dadAX operon
GTTCAGCAGGAGATACTA
1237409 1237426 + 9648752
MF099078 dadAX operon
NA
1236718 1236738 + 9648752
MF099084 ilvIH operon
GTCTGGTTTATTCTGCATTTT
85341 85361 + 8429549
MF099085 ilvIH operon
AATGTAGAATTTTATTCTGAA
85368 85388 + 8429549
MF099086 ilvIH operon
AGCCGATTTATTATCAATTTAAT
85454 85476 + 8429549
MF099087 ilvIH operon
AATGGAGGATTTTATCGTT
85484 85502 + 8429549
MF099088 ilvIH operon
CTCCTGTTTATTCTTATT
85517 85534 + 8429549
MF099089 ilvIH operon
CCCGTGTTTATGTCTCT
85537 85553 + 8429549
MF099170 ompC operon + micF operon
acatgaaagttaaagtactg
2310752 2310771 +/- 8002608
MF099173 ompC operon + micF operon
ggcatataacagaggg
2310778 2310793 +/- 8002608
MF099175 ompC operon + micF operon
aatggacttgccgactg
2310841 2310857 +/- 8002608
MF099176 ompC operon + micF operon
ttcgtgttggattattctgc
2310870 2310889 +/- 8002608
MF099177 ompC operon + micF operon
ttgacattcagtgctgtc
2311052 2311069 +/- 8002608
MF099178 ompC operon + micF operon
gaatgacggtaataaataaagt
2311117 2311138 +/- 8002608
MF099180 ompC operon + micF operon
ttgaaataggggtaaa
2311154 2311169 +/- 8002608
MF099181 ompC operon + micF operon
gtaaaaaaaaccgaat
2311183 2311198 +/- 8002608
MF099182 ompC operon + micF operon
gtggtagcacagaataatgaaaag
2311212 2311235 +/- 8002608
MF099234 gcvTHP operon
TTTTTTGGTTTTTTATTCTG
3050865 3050884 - 7928983
MF099238 gcvTHP operon
TTAATATTGTCTTATTCAA
3050928 3050946 - 7928983
MF099241 lysU operon
aaaccattttgatggttatttattagtgatatcaacttgaggtaa
4352417 4352446 - 1569010
MF099486 gltBDF operon
GATGGATTTTAGGCAAAAACAGTAGCATGA
3354236 3354265 + 9889287
MF099487 gltBDF operon
CCAATTAAGGCAGTATAAAATGCTGGTTTT
3354276 3354305 + 9889287
MF099488 kbl-tdh operon
GTTACACGTTATTTATCCTGAATTTTGCAG
3792631 3792660 - 9889287