Details for MX000097

General Information

MX000097

Mlc

b1594

Escherichia coli str. K-12 substr. MG1655, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 1 5 6 5 3
T 0 0 0 0 0 4
G 0 6 0 1 1 0
C 7 0 2 0 1 0
Consensus C G M A M W

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098322 ptsG operon
TTATTTTACTCTGTGTAATAAAT
1157749 1157771 + 12588863
MF098323 ptsG operon
TTTTTTTAAAGCTCGTAATTAAT
1157580 1157602 + 12588863
MF099100 malT operon
ATTAATTACGAAGCGCAAAAAAA
3553024 3553046 + 9529892
MF099369 manXYZ operon
ATTTTTTCGATATCTAAAATAAAT
1901908 1901931 + 9484892
MF099370 manXYZ operon
GGATATTTTACCTTTCGAAATTTCT
1901841 1901865 + 9484892
MF099372 mlc operon
attatttcggagcgcgaaaatat
1666601 1666623 - 9484893
MF099373 ptsH operon
ATTATTTTGATGCGCGAAATTAA
2533502 2533524 + 10411743