Details for MX000098

General Information

MX000098

DnaA

b3702

Escherichia coli str. K-12 substr. MG1655, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 2 0 24 3 4 0 19 5 23
T 24 25 2 25 8 2 3 0 3
G 0 1 2 1 1 1 5 2 2
C 3 3 1 0 16 26 2 22 1
Consensus T T A T Y C R C A

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098273 nrdAB operon
TTATCCACAAAGTTATGCACT
2344703 2344723 + 9680219
MF098321 dnaAN-recF operon
tgtggataa
3881568 3881576 - 8830699
MF098354 guaBA operon
tctgtataa
2632135 2632143 - 8828209
MF098355 guaBA operon
ttatccaca
2631877 2631885 - 8828209
MF098820 polA operon
GTTATCCACAT
4046833 4046843 + 9106210
MF098821 polA operon
CTATCCACA
4046693 4046701 + 9106210
MF098824 rpoH operon
GTTATACTCTT
3601008 3601018 - 3323832
MF098825 aldA operon
GAATTGTCCTTTCACGATTCCGTCTCTCTGATGATTGATGTTAATTAACAATGTATTCACCGAAAACAAACATATAAATC
1488139 1488218 + 11160809
MF098826 dnaANrecF operon
ATCTGTGAGAAACAG
3883915 3883929 - 10545126
MF098830 uvrB operon
GTTATCCACTATTCCTGTGGATAAC
813106 813130 + 2987838
MF098831 rpoH operon
TGTGGATAA
3600890 3600898 - 2540187
MF098832 rpoH operon
TTATTCACA
3600914 3600922 - 2540187
MF098844 proSyaeF operon
TTATCCGCA
219050 219058 - 1688424
MF098845 proSyaeF operon
TTATCCGCG
219030 219038 - 1688424
MF098879 yjeS operon
TTATCCTCA
4393575 4393583 - 8830270
MF098881 mioC operon
ttttccacagg
3924141 3924151 - 2421247
MF100182 oriC
10692160
MF100215 orf2.1/8.6 operon
8830270
MF100226 oriC
10692160
MF100287 oriC
10692160
MF100319 oriC
10692160
MF100323 orf2.1/8.6 operon
8830270
MF100360 orf2.1/8.6 operon
8830270
MF100452 oriC
10692160
MF100472 orf2.1/8.6 operon
8830270
MF100504 oriC
10692160
MF100577 oriC
10692160
MF100670 oriC
10692160