Details for MX000100

General Information

MX000100

RpoN

b3202

Escherichia coli str. K-12 substr. MG1655, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 2 2 3 3 5 5 3 2 3 5 3 3 2 5 4 4 3 2 4 7 8 7 4 1 0 1 0 0 9 2 6 6 6 5 3 3 1 0 1 5 1 3 4 6 1 1 2 0 1
T 3 3 4 3 2 1 5 5 1 0 2 1 2 2 1 3 5 4 3 0 1 1 1 4 8 0 0 1 0 2 0 0 2 4 3 5 7 1 1 4 7 4 2 3 1 3 6 4 3
G 1 3 1 1 1 2 0 1 2 2 2 4 2 0 4 0 0 2 0 1 0 0 4 1 1 8 9 0 0 0 3 1 1 0 1 0 0 7 0 0 0 2 1 0 4 3 1 5 3
C 3 1 1 2 1 1 1 1 3 2 2 1 3 2 0 2 1 1 2 1 0 1 0 3 0 0 0 8 0 5 0 2 0 0 2 1 1 1 7 0 1 0 2 0 3 2 0 0 2
Consensus N N N N N N W N N V N N N H R H W N H A A A R N T G G C A H R M W W N W T G C W T D N W N N W K N

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098627 fdhF operon
CAGGGAATGACCCCACATAAAATGTGGCATAAAAGATGCATACTGTAGTC
4299408 4299457 - 10536136
MF098628 hycABCDEFGHI operon
CTTTAATAACAATAAATTAAAAGTTGGCACAAAAAATGCTTAAAGCTGGCA
2850461 2850511 - 10536136
MF098629 hypABCDE operon
ATTCACCGCAGGGATAATCAACACTGGCACAATTATTGCTTGTAGCTGGCA
2850577 2850627 + 10536136
MF098630 glnA operon
GCCTTTTAGGGGCAATTTAAAAGTTGGCACAGATTTCGCTTTATCTTTTTT
4058107 4058157 - 10536136
MF098631 nac operon
TGTACATCAACACCAAAATAAAACTGGCAAGCATCTTGCAATCTGGTTGTA
2061978 2062028 - 10536136
MF098632 glnHPQ operon
CGAAAAATCAAGGAGTTGCAAAACTGGCACGATTTTTTCATATATGTGAATG
848047 848098 - 10536136
MF098633 pspABCDE operon
TTATAAATCAAAAAGATAAAAAATTGGCACGCAAATTGTATTAACAGTTCA
1367988 1368038 + 10536136
MF098640 argT operon
TGAATGTTACTGTTGTCGTCAAGATGGCATAAGACCTGCATGAAAGAGCC
2427850 2427899 - 10536136
MF098641 fixABCX operon
AATCAGTTTGTTATGCTCTGTTGTGAGTAAAAAATAACATCTGACTTTCA
42136 42185 + 10536136