Details for MX000105

General Information

MX000105

GlpR

PA3583

Pseudomonas aeruginosa PAO1 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 2 0 0 0 0 0 0 0 3 3 3 0 0 0 3 3 2 3 3 0
T 1 1 1 1 3 3 0 0 0 0 0 2 3 0 0 0 0 0 0 1
G 0 0 0 0 0 0 0 3 0 0 0 0 0 3 0 0 0 0 0 2
C 0 2 2 2 0 0 3 0 0 0 0 1 0 0 0 0 1 0 0 0
Consensus W Y Y Y T T C G A A A Y T G A A M A A K

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098415 glpD operon
NA
4016387 4016406 + 8752340
MF098416 glpD operon
ACCCTTCGAAATTGAAAAAG
4016325 4016344 + 8752340
MF098417 glpFK operon
TTTTTTCGAAACTGAACAAT
4012739 4012758 + 9141691