Details for MX000110

General Information

MX000110

Vfr

PA0652

Escherichia coli str. K-12 substr. MG1655, complete genome.

Pseudomonas aeruginosa PAO1 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 0 1 0 2 1 1 0 2 0 1 0 0 3 0 2 0 1 0
T 3 0 2 0 1 1 1 3 0 0 1 3 0 0 0 1 2 2 3
G 0 3 0 2 0 1 0 0 0 3 0 0 0 0 0 0 0 0 0
C 0 0 0 1 0 0 1 0 1 0 1 0 3 0 3 0 1 0 0
Consensus T G W S W D H T M G H T C A C W Y W T

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098147 lacZYA operon
AATGTGAGTTAGCTCACTCAT
366394 366414 - 2166165
MF098432 lasR operon
aAaTGTGAtctagaTCACAttt
1557882 1557903 + 9190808
MF098462 fleQ operon
AAATTGACTAATCGTTCACATTTG
1187459 1187482 + 12218009