Details for MX000115

General Information

MX000115

AraC

b0064

Escherichia coli str. K-12 substr. MG1655, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 3 4 1 0 1 7 1 7 6 2 3 5 0 4 1 1 2 0 5 5 4 4 3 2 1 0 4 0 6
T 3 0 7 1 3 0 7 0 1 3 2 3 4 0 0 1 0 2 1 2 2 2 1 5 0 1 3 4 1
G 0 3 0 2 0 0 0 1 0 3 1 0 2 4 6 1 3 5 2 1 0 0 4 1 0 0 0 2 1
C 2 1 0 5 4 1 0 0 1 0 2 0 2 0 1 5 3 1 0 0 2 2 0 0 7 7 1 2 0
Consensus H R T S Y A T A M D N W B R R N V K R W H H R W C C W B R

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098661 araFGH operon
TTATGTCTTTTCCCGCTAAATTTATGCACGTTCTCACTGTAATTCT
1986293 1986338 - 1447222
MF098662 araFGH operon
CAACAAGGATTTCCAGGCTAATCTTATGGATTAATCTGCTGTGC
1986372 1986415 - 1447222
MF098663 araJ operon
AACTATTCAGCAGGATAATGAATACAGAGGGGCGAATTATCTCTT
412564 412608 - 2231717
MF098664 araBAD operon
TATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGA
70110 70154 - 6262769
MF098665 araE operon
CATGTCGCAGCAATTTAATCCATATTTATGCTGTTTCCGACCTGA
2982244 2982288 - 1447222
MF098667 araC operon
aatgtggacttttctgccgtgattatagacacttttgttacg
70182 70223 + 6089170