Details for MX000118

General Information

MX000118

CynR

b0338

Escherichia coli str. K-12 substr. MG1655, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 0 0 2 0 2 2 0 0 2 2 2 0 0 0 2 2 0 0 0 2 2 0 0 0 2 0 0 2 0 2 2 2 0 0 2 0 2 0 0 0 0 0 2 0 0 0 0 2 0 0 2 0 2
T 0 0 2 0 2 0 0 0 2 0 0 0 2 0 0 0 0 2 0 0 0 0 0 2 0 0 2 0 0 2 0 0 0 2 0 0 0 0 0 2 2 2 2 0 0 0 2 2 0 2 0 0 0 0
G 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0
C 2 2 0 0 0 0 0 0 0 0 0 0 0 2 2 0 0 0 0 0 0 0 2 0 2 0 0 2 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 2 2 0 0 0 0 0 0 2 0
Consensus C C T A T A A G T A A A T C C A A T G G A A C T C A T C A T A A A T G A G A C T T T T A C C T T A T G A C A

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098787 cynTSX operon
CCTATAAGTAAATCCAATGGAACTCATCATAAATGAGACTTTTACCTTATGACAAT
358697 358752 + 7961413
MF098791 cynR operon
tgtcataaggtaaaagtctcatttatgatgagttccattggatttacttataggttgcga
357915 357974 - 7961413