Details for MX000171

General Information

MX000171

RhaS

b3905

Escherichia coli str. K-12 substr. MG1655, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 1 0 1 1 0 0 0 0 0 0 0 1 0 0 0 0 0 2 1 0 1 1 1 0 0 1 1 0 1 1 0 0 0 0 0 0 1 1 1 1 2 0 0 1 0 2 2 1 0
T 1 2 0 1 2 1 0 0 0 2 0 0 2 2 0 0 0 0 0 2 0 0 0 1 0 0 1 1 1 1 0 0 1 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0
G 0 0 0 0 0 1 0 0 1 0 2 1 0 0 2 0 0 0 1 0 1 1 0 0 0 1 0 0 0 0 0 1 1 1 1 1 0 1 0 0 0 1 2 0 2 0 0 1 2
C 0 0 1 0 0 0 2 2 1 0 0 0 0 0 0 2 2 0 0 0 0 0 1 1 2 0 0 1 0 0 2 1 0 1 0 1 1 0 0 1 0 1 0 1 0 0 0 0 0
Consensus W T M W T K C C S T G R T T G C C A R T R R M Y C R W Y W W C S K S K S M R W M A S G M G A A R G

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF099500 rhaT operon
TTAATGCCGTGATTGCCAGTAAATCGACAACGGCGGCAACAGGCGAAAG
4100600 4100648 - 8757746
MF099501 rhaBAD operon
ATCTTTCCCTGGTTGCCAATGGCCCATTTTCCTGTCAGTAACGAGAAGGT
4097504 4097553 - 8230210