Details for MX000183

General Information

MX000183

TrpR

b4393

Escherichia coli str. K-12 substr. MG1655, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 0 0 5 0 0 3 0 1 0 3 3 1 0 3 0 0 3 0 3
T 3 0 5 0 0 5 0 1 4 3 2 0 0 4 0 0 5 1 1 0
G 0 5 0 0 0 0 0 4 0 2 0 2 0 1 2 5 0 1 0 2
C 2 0 0 0 5 0 2 0 0 0 0 0 4 0 0 0 0 0 4 0
Consensus Y G T A C T M G T K W R C T R G T D C R

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF099531 trpR operon
CGTACTCTTTAGCGAGTACA
4632694 4632713 + 10518785
MF099534 aroL operon
ATTGTACTAGTTTGATGGTATGAT
406324 406347 + 7961453
MF099538 aroH operon
CGCCGAATGTACTAGAGAACTAGTGCATTAGCTTAT
1788264 1788299 + 2189726
MF099539 trpABCDE operon
TAATCATCGAACTAGTTAACTAGTACGCAAGTTCAC
1323101 1323136 - 2189726
MF099540 mtr operon
TTTTGTACTCGTGTACTGGTACAGTG
3305867 3305892 - 10518785