Details for MX000186

General Information

MX000186

AlgZ

PA3385

Pseudomonas aeruginosa PAO1 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 0 0 0 3 1 1 3 0 0 1 1 1 0
T 1 0 0 0 0 2 1 0 1 0 0 0 0 0
G 2 3 1 0 0 0 0 0 0 1 0 1 1 1
C 0 0 2 3 0 0 1 0 2 2 2 1 1 2
Consensus K G S C A W H A Y S M V V S

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098400 algD-algA operon
GTAATCCATTGGCCATTACCAGCCTCCCGCCATTAC
3962159 3962194 + 7928961
MF099573 algZ operon
GAAGGCCATCATCCAACC
3791121 3791138 + 15968052
MF099574 algZ operon
CAGATAGCTGGTACTGGCAAAACGCCGGCACGCAACGCA
3791179 3791217 + 15968052