Details for MX000188

General Information

MX000188

SarA

SACOL0672

Escherichia coli str. K-12 substr. MG1655, complete genome.

Staphylococcus aureus subsp. aureus COL chromosome, complete genome.

Staphylococcus aureus subsp. aureus MRSA252 chromosome, complete genome.

NCBI

Frequency Matrix

A 14 12 8 5 13 5 12 12 7 7 10 8 13 13 7 10
T 7 9 12 15 7 15 7 9 11 14 12 10 11 7 9 11
G 1 2 3 3 4 1 3 2 2 2 1 4 0 1 4 0
C 2 1 1 1 0 3 2 1 4 1 1 2 0 3 4 3
Consensus W W W W W W N W N W W N W W N W

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF099578 sarV operon
ATTTGTAATAGATAAAATGC
2324786 2324805 - 15292128
MF099579 sarV operon
AAGTTTGATATATAATAAATTTAAG
2324760 2324784 - 15292128
MF099580 hla operon
ATTTTTATTTAATAGTTAATTAATTG
1181398 1181423 - 10601279
MF099581 spa operon
AATTATAAATATAGATTTTAG
108953 108973 - 10601279
MF099582 agrABCD operon
ATTTTCCAATTTTTCTT
2082962 2082978 + 10411747
MF099583 agrABCD operon
GTCGTTTTTTATTCTT
2082984 2082999 + 10411747
MF099584 agrABCD operon
TTAAATACAAATTACA
2083027 2083042 + 10411747
MF099585 agrABCD operon
AGTTAAGTATTTATTT
2083049 2083064 + 10411747
MF099586 agrABCD operon
CAATATAATGATAAAAGAT
2083077 2083095 + 10411747
MF099587 agrABCD operon
CTAAATCGTATAATGACA
2083100 2083117 + 10411747
MF099588 fnbA operon
TCTGATGACTTGAATACAATTTATAGGTATATTTCAAATAATAAAATTATCAATTAACATAAAATTAATGACAATCTTAACTTTTCATTAACTCGCTTTTTT
2572585 2572686 - 10760180
MF099589 icaABD operon
AGGAAAATTAAGTTGCAATTACAAAT
2763198 2763223 - 15774878
MF099590 icaABD operon
AATTATAACAACAATCTATTGCAAAT
2763234 2763259 - 15774878
MF099591 icaABD operon
TATTGCAAATTAAAATACTATCAATT
2763250 2763275 - 15774878
MF099592 icaABD operon
AATTAAAATACTATCAATTACCATAT
2763257 2763282 - 15774878
MF099593 sspA operon
ATATTTAACTTGTAAATAAATTTTTTGGA
1064036 1064064 - 12867449
MF099594 tst operon
NA
2060905 2060931 + 9829932
MF099595 hlb operon
AAATATAAATTCTATTTAATAATTAATTT
2063636 2063664 + 9829932
MF099596 seb operon
TAATGTTTTTTTAATTGAATATTTAAGAT
916386 916414 + 9829932
MF099597 cna operon
TTATTATTAGTATCCTGTGGATATGACATAGAGTATAAGGAGGGGTTTTT
2880340 2880389 - 12867449
MF099598 cna operon
ATGCACTTGTATTCGTTATACTGTATATATTTTGCATAATAAAATAATAA
2880440 2880489 - 12867449
MF099599 cna operon
TATATTTTGCATAATAAAATAATAATATGAATTTTTGATAAATTTCATTG
2880415 2880464 - 12867449
MF099600 cna operon
TATGAATTTTTGATAAATTTCATTGAATAAGAACTAAATTAGTTTATAAT
2880390 2880439 - 12867449
MF099601 cna operon
AATAAGAACTAAATTAGTTTATAATTTATTATTAGTATCCTGTGGATATG
2880365 2880414 - 12867449
MF100148 artificial site
12867449
MF100155 artificial site
12867449
MF100163 artificial site
12867449
MF100164 artificial site
12867449
MF100173 artificial site
12867449
MF100186 artificial site
12867449
MF100193 artificial site
12867449
MF100210 artificial site
12867449
MF100213 artificial site
12867449
MF100233 artificial site
12867449
MF100234 artificial site
12867449
MF100245 artificial site
12867449
MF100255 artificial site
12867449
MF100259 artificial site
12867449
MF100275 artificial site
12867449
MF100285 artificial site
12867449
MF100294 artificial site
12867449
MF100301 artificial site
12867449
MF100311 artificial site
12867449
MF100327 artificial site
12867449
MF100334 artificial site
12867449
MF100338 artificial site
12867449
MF100351 artificial site
12867449
MF100354 artificial site
12867449
MF100372 artificial site
12867449
MF100401 artificial site
12867449
MF100403 artificial site
12867449
MF100412 artificial site
12867449
MF100425 artificial site
12867449
MF100427 artificial site
12867449
MF100431 artificial site
12867449
MF100437 artificial site
12867449
MF100441 artificial site
12867449
MF100466 artificial site
12867449
MF100485 artificial site
12867449
MF100488 artificial site
12867449
MF100489 artificial site
12867449
MF100499 artificial site
12867449
MF100501 artificial site
12867449
MF100509 artificial site
12867449
MF100527 artificial site
12867449
MF100543 artificial site
12867449
MF100548 artificial site
12867449
MF100549 artificial site
12867449
MF100560 artificial site
12867449
MF100562 artificial site
12867449
MF100565 artificial site
12867449
MF100598 artificial site
12867449
MF100616 artificial site
12867449
MF100620 artificial site
12867449
MF100621 artificial site
12867449
MF100628 artificial site
12867449
MF100632 artificial site
12867449
MF100640 artificial site
12867449
MF100656 artificial site
12867449
MF100660 artificial site
12867449