Details for MX000208

General Information

MX000208

PrrA

RSP_2925

Rhodobacter sphaeroides 2.4.1 chromosome 1, complete sequence.

NCBI GenBank BacDive

Frequency Matrix

A 0 1 0 0 0 0 2 2 0 0 0 0 0 0 2 0
T 2 0 0 0 1 0 0 0 3 0 0 0 1 0 1 1
G 1 2 1 3 2 0 1 0 0 1 2 2 1 1 0 0
C 0 0 2 0 0 3 0 1 0 2 1 1 1 2 0 2
Consensus K R S G K C R M T S S S B S W Y

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF099664 cycA operon
GACTCGTTGTGCGGCAATCCGTCATA
2025057 2025082 + 10564521
MF100065 hemA operon
GATTGCGTGCTGGCGGTGGCCGATTGACGCAGGG
1676044 1676077 - 18689483
MF100066 hemA operon
GGCCCGAGGGCGCTGGCGGTCTCGCCGGCCACCGGGCGCTGGGGCATCGGGACCGGAGCGGGGG
1676125 1676188 - 18689483