Details for MX000212

General Information

MX000212

Abh

BSU14480

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 0 0 1 0 0 2 2 1 2 1 2 0 2 0 1 1 1 0 0 0 1 1 0 0 2 1 0 2 1 1 0 0 1 2
T 1 1 2 1 2 0 0 0 1 0 1 0 1 0 1 0 1 1 2 1 0 1 1 1 2 0 0 2 0 0 1 1 2 0 0
G 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 1 2 0 0 1 0 0 1 0 0 0 0 0 0 1 0
C 1 1 0 0 0 2 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0
Consensus Y Y T W T C A A W A W A Y A K R W W T K G W W K T A R T A M W Y T R A

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF100052 sunA operon
TTAGTGTATTACAACCAATTCTGTTTATTGATAGG
2269836 2269870 - 17720793
MF100056 sboA operon
AGGAAATGTTACATTTTTCCGAAATCTATCATTTCCTTTTCACATTTTTTTCAAAATATATGTATTGAATTAGTAATTTGATAGTTTTAAGATAAAAGT
3835914 3836012 + 17720793