Details for MX000218

General Information

MX000218

Lrp

JW0872

Escherichia coli str. K-12 substr. W3110, complete genome.

NCBI

Frequency Matrix

A 0 5 0 0 4 2 1 3 2 3 1 1 1 1 0 1
T 0 0 1 4 0 1 0 0 1 0 3 2 0 2 1 3
G 0 0 3 0 0 2 2 2 2 2 1 2 2 1 2 1
C 5 0 1 1 1 0 2 0 0 0 0 0 2 1 2 0
Consensus C A G T A R S A R A T K S T S T

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF099984 gltB operon
CAGTATAAAATGCTGG
3354141 3354156 + 18405378
MF099985 gltB operon
CAGTAGCATGAAACGTC
3354110 3354126 + 18405378
MF099986 gltB operon
CAGTCAGGAATTGACTG
3354204 3354220 + 18405378
MF099987 lrp operon
GATTAAATGATGAATAAACGCCCCTGTTAATGA
932645 932677 + 18405378
MF099988 lrp operon
ATATCTGGCATGTTGTACTAAAAATCGATGTTTTGCTTTGACAATCCCCTGGTG
932678 932731 + 18405378