Details for MX000221

General Information

MX000221

LasR

PA1430

Pseudomonas aeruginosa PAO1 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 2 6 2 0 3 3 3 2 3 4 4 4 1 3
T 0 2 1 1 0 5 2 2 3 3 3 2 0 5 3
G 2 0 1 0 2 1 4 2 1 0 2 3 2 0 1
C 6 4 1 6 7 0 0 2 3 3 0 0 3 2 1
Consensus C C A C C T G N Y H A A A T W

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF098386 hcnABC operon
ACCCCACCTACCAGAATTGGCAGGGG
2412430 2412455 + 15505212
MF098387 hcnABC operon
ACCGCGCGTTTCCACCAGGG
2412308 2412327 + 11544214
MF098418 lasB operon
ACCTGCTTTTCTGCTAGCTA
4170717 4170736 - 15505212
MF098419 lasB operon
acCTgccagttctggcAGgt
4170657 4170676 - 8576049
MF098425 rsaL operon
AATTTTATAACTAGCAAAT
1559188 1559206 - 10094696
MF099575 PA0572 operon
AAAACAACCAGAACAGATAGTTTTTCC
627921 627947 - 15505212
MF099576 PA3904 operon
CCTCCTGAGCAGTTCAGATAGGTTGT
4373858 4373883 + 15505212
MF099577 PA4677 operon
GCCGGCAACTAGCTATCACTTGGAGTAGCTGGCTGGCCTTCT
5247562 5247603 - 15505212
MF099970 vqsR operon
ACCTACCAGAACTGGTAGTT
2934483 2934502 - 17449616