Details for MX000227

General Information

MX000227

PhoP

BSU29110

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 3 5 5 8 5 7 5 0 3 4 5 8 4 6 3 6 7 5 6
T 5 7 2 4 5 7 8 1 3 10 8 4 4 4 8 5 3 3 4
G 1 1 1 1 2 0 1 3 1 0 1 0 3 3 2 3 1 2 3
C 4 0 5 0 1 0 0 10 7 0 0 2 3 1 1 0 3 4 1
Consensus T T M A W W T C C T T A N A T A A A A

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097590 phoD operon
ttgtttttttaagatcatgtgaagaaaaa
283321 283351 + 10094677
MF097738 phoB operon
TCTTGTAAATCCAATCTTTAAAATCGATTAATACTAGCTTAACAGTTTAAAAATATAATT
621528 621587 - 9335276
MF097739 phoD operon
tcagcgcTTACAAtcagTTCACActtcTTCACAgtcgtTTAACAatgat
283919 283967 + 10094677
MF097740 ykoL operon
TAAATTCTTTACATTAGATTCATACCACGTTCATT
1398097 1398131 + 10671441
MF097741 resA operon
CGCTTTCTAAATttcacaTAACCttcaaaaAGTAAGAAATGTGAAATGAACGTGCAATGATATAATT
2421381 2421447 - 9988472
MF097765 tagA operon
GAGACTATTCACAATATTCCTTATGTTAACAGTAACT
3681379 3681415 + 9611818
MF097766 tagA operon
GGTTTTTAACTATATAAATAGAATCTTAAAGGAAGGAGG
3681323 3681361 + 9457886
MF097767 tagA operon
GGAAACATATTTAAATTTAATGTAAAGATAATGTTAATCCTTTGTTGAAGATTTATGTTAAAATATAAGGTAGCTTGATTTTGCTT
3681225 3681310 + 9457886
MF097768 tagD operon
AGTCTGAGTGTAATTACATATTTTGGAATGTTTTTCTCCTCATGAGTACTTAACCTTTTTT
3681115 3681175 - 9457886
MF097769 tagD operon
TGTTTTTAATAGTGTTTAACATTAGGAAGGA
3680983 3681013 - 9457886
MF097770 tagD operon
ATGAAAAAAGTTATCACATATGGAACTTTTGATTTACTGCATTGGGG
3680924 3680970 - 9457886
MF100289 phoA operon
9611818
MF100365 tuaA operon
9611818
MF100434 pstS operon
9611818