Details for MX000229

General Information

MX000229

ComA

BSU31680

Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 2 2 1 1 1 1 0 1 2 3 3 3 2 1 1 1 0 1 2 1
T 2 2 2 2 0 1 0 1 0 0 1 0 1 1 2 3 3 1 1 1
G 0 0 1 0 2 2 4 0 2 0 0 0 1 1 1 0 0 0 1 1
C 0 0 0 1 1 0 0 2 0 1 0 1 0 1 0 0 1 2 0 1
Consensus W W T T G G G C R A A A A N T T T C A N

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF097787 rapCphrC operon
TTTATTGCGTGCTCCCGAAA
428723 428742 + 10464187