Details for MX000242

General Information

MX000242

SarA

NWMN_0588

Staphylococcus aureus subsp. aureus str. Newman chromosome, complete genome.

NCBI

Frequency Matrix

A 1 1 1 1 2 0 1 1 2 0 1 0 1 2 0 1 1 1 1
T 1 1 1 1 0 2 1 1 0 0 1 2 1 0 1 1 1 1 1
G 0 0 0 0 0 0 0 0 0 2 0 0 0 0 1 0 0 0 0
C 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Consensus W W W W A T W W A G W T W A K W W W W

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF100077 sarA operon
ATTAGTTATAATTAACTAAATAATA
669378 669402 - 18178734
MF100078 sarA operon
ATAATAAATAAAGATTAGATATCAAT
669295 669320 - 18178734