Details for MX000268

General Information

MX000268

NikR

HP1338

Helicobacter pylori 26695 chromosome, complete genome.

imported from the CollecTF database

NCBI

Frequency Matrix

A 1 0 2 0 17 6 0 19 0 5 19 12 4 3 4 8 7 8 5 7 15 12 9 3 14 10 0 17 3 1 1 2 0 0 0
T 0 2 0 15 0 12 12 0 11 13 0 5 13 13 5 4 10 11 14 12 4 5 4 14 3 7 15 2 0 3 3 0 0 1 1
G 0 0 0 0 0 1 0 0 0 1 0 2 2 3 0 4 0 0 0 0 0 2 6 0 1 1 1 0 0 0 0 1 1 0 0
C 0 0 0 3 1 0 7 0 8 0 0 0 0 0 10 3 2 0 0 0 0 0 0 2 1 1 3 0 1 0 0 0 1 0 0
Consensus A T A T A T T A T T A A T T C A T T T T A A A T A A T A A T T A S T T

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF103273 HP0073 operon
TATAACACTAATTCATTTTAAATAATAATTAGTT
78065 78098 - 16343630
MF103274 HP0073 operon
ATATAACACTAATTCATTTTAAATAATAATTA
78068 78099 - 18790698
MF103275 HP0073 operon
TAACACTAATTCATTTTAAATAATA
78072 78096 - 17522054
MF103276 HP0073 operon
TAACACTAATTCATTTTAAATAATA
78072 78096 - 22549756
MF103277 HP0073 operon
TAACACTAATTCATTTTAAATAATA
78072 78096 - 19119856
MF103278 HP0073 operon
TAACACTAATTCATTTTAAATAATA
78072 78096 - 17291009
MF103279 HP1027 operon
TCTTATAAGTTACATTAAAATGCGA
1090053 1090077 + 19119856
MF103280 HP1027 operon
CATTATTATTGTATAATAATATTCT
1090148 1090172 + 19119856
MF103281 HP1077 operon
TATTACAATTACCAAAAAAGTATTA
1136921 1136945 - 17522054
MF103282 HP1077 operon
TATTACAATTACCAAAAAAGTATTA
1136921 1136945 - 19119856
MF103283 HP1338 operon
GCATGAGTTCGTTAAAAGCCGCTCATGC
1398794 1398821 + 12890020
MF103284 HP1338 operon
TATTATAATTGTTCATTTTAAATTA
1398836 1398860 - 22549756
MF103285 HP1338 operon
TATTATAATTGTTCATTTTAAATTA
1398836 1398860 - 19119856
MF103286 HP1339 operon
TATTATTAAAACAATATAATCAACA
1398938 1398962 + 19119856
MF103287 HP1400 operon
CATTATTAAGTTTTTTTTGTTTTTA
1461319 1461343 + 17015456
MF103288 HP1400 operon
CATTATTAAGTTTTTTTTGTTTTTA
1461319 1461343 + 19119856
MF103289 HP1512 operon
TATTATTAAATAGAATAATGTAATAATA
1584359 1584386 + 17030579
MF103290 HP1512 operon
TATTATTAAATAGAATAATGTAATA
1584359 1584383 + 17015456
MF103291 HP1512 operon
TATTATTAAATAGAATAATGTAATA
1584359 1584383 + 19119856