Details for MX000272

General Information

MX000272

DosR

RVBD_3133c

Mycobacterium tuberculosis H37Rv, complete genome.

imported from the CollecTF database

NCBI

Frequency Matrix

A 4 0 3 2 0 1 6 2 1 9 6 3 1 2 1 0 0 1 6 3
T 6 3 1 1 0 0 3 0 5 3 4 5 2 3 2 0 0 4 4 1
G 4 3 4 8 14 13 3 2 4 1 2 1 9 7 1 0 0 3 1 9
C 0 5 3 3 0 0 2 10 4 1 2 5 2 2 10 14 14 6 3 1
Consensus T C G G G G A C T A A Y G G C C C C A G

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF103344 RVBD_1738 operon
TTAGGGCCGGAAGTCCCCAA
1965468 1965487 + 18502855
MF103345 RVBD_1738 operon
TGGCGGACGAATGACCCCAG
1965508 1965527 + 18502855
MF103346 RVBD_1738 operon
GCCGGGACTTCAGGCCCTAT
1965530 1965549 + 18502855
MF103347 RVBD_2031c operon
TGGGGACCATTGACCCTG
2279061 2279078 + 18391009
MF103348 RVBD_2031c operon
GCGGGCCATTTGTCCGCG
2279026 2279043 + 18391009
MF103349 RVBD_2031c operon
TAGGGACAGAAGTCCCCG
2279004 2279021 + 18391009
MF103350 RVBD_2031c operon
TCGGGGACTTCTGTCCCTAG
2279003 2279022 - 12694625
MF103351 RVBD_2031c operon
ACAGGGTCAATGGTCCCCAA
2279060 2279079 - 12694625
MF103352 RVBD_3134c operon
GTGGGGACCAACGCCCCTGG
3500819 3500838 - 18359816
MF103353 RVBD_3134c operon
ATAAGGACTAACGGCCCTCA
3500840 3500859 - 18359816
MF103354 RVBD_3134c operon
ACCTGGACGAGCCACCCGTG
3500911 3500930 - 16339949
MF103355 RVBD_3134c operon
ACGGGATGTATCCGCCCCAG
3500761 3500780 - 16339949
MF103356 RVBD_3134c operon
GGTCGGCCTTATGCCCCGTG
3500348 3500367 - 16339949
MF103357 RVBD_3134c operon
TGCGGGTGGATCGGGCCATC
3500084 3500103 - 16339949