Details for MX000275

General Information

MX000275

Zur

Rv2359

Mycobacterium tuberculosis H37Rv complete genome.

imported from the CollecTF database

NCBI

Frequency Matrix

A 0 1 2 0 4 3 0 0 4 4 5 5 0 1 3 0 0 1 0 0 2 4 0 5 5 0 1
T 0 1 2 5 0 2 5 0 0 0 0 0 4 1 0 5 4 4 5 0 0 0 3 0 0 0 0
G 1 0 0 0 1 0 0 5 1 0 0 0 0 0 2 0 1 0 0 0 3 1 0 0 0 3 0
C 4 0 1 0 0 0 0 0 0 1 0 0 1 3 0 0 0 0 0 5 0 0 2 0 0 2 2
Consensus C W W T A A T G A A A A T C A T T T T C G A T A A G C

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF103402 Rv0105c operon
CCTGTTGAAAATAGTTTTCGACAACC
124287 124312 + 17098899
MF103403 Rv2058c operon
CTTATTGAAAATCATTTTCGACAACA
2315087 2315112 + 17098899
MF103404 Rv2059 operon
CAATAATGAAAACTGTTATCGATAAG
2315141 2315166 + 17098899
MF103405 Rv0106 operon
GTTTAATGGCAATCATTTTCAATAAG
124340 124365 + 17098899
MF103406 Rv0280 operon
CATAATGAAAATCATGTTCAGTAAGC
341942 341967 + 17098899