Details for MX000278

General Information

MX000278

CueR

PA4778

Pseudomonas aeruginosa PAO1 chromosome, complete genome.

imported from the CollecTF database

NCBI GenBank BacDive

Frequency Matrix

A 0 1 1 0 0 0 5 0 0 0 0 0 2 0 5 1 0 3 0 0 0 0 5 4 0 1 0 0 0 5 2 2 2 0
T 1 0 0 5 5 0 0 0 0 5 5 0 1 0 0 0 0 0 5 0 3 0 0 0 0 0 3 3 1 0 2 0 0 4
G 4 4 2 0 0 5 0 0 0 0 0 5 0 0 0 0 3 2 0 5 2 0 0 1 5 3 0 0 3 0 0 2 2 0
C 0 0 2 0 0 0 0 5 5 0 0 0 2 5 0 4 2 0 0 0 0 5 0 0 0 1 2 2 1 0 1 1 1 1
Consensus G G S T T G A C C T T G M C A C G A T G T C A A G G T T G A W R R T

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF103438 PA3920 operon
GGCTTGACCTTGACACGATGTCAAGGCTGAACCT
4389128 4389161 + 20233934
MF103439 PA3519 operon
TGCTTGACCTTGCCACCGTGGCAAGCTTTACGGT
3936873 3936906 - 20233934
MF103440 PA3523 operon
GGGTTGACCTTGCCAAGGTGTCAAGGTCGATAAC
3943869 3943902 - 20233934
MF103441 PA3575 operon
GGATTGACCTTGACACCATGTCAAGGTCGAAAAT
4007357 4007390 - 20233934
MF103442 PA3520 operon
GAGTTGACCTTGTCACGATGGCAGGACTCATGGT
3937463 3937496 - 20233934