Details for MX000282

General Information

MX000282

MexT

PA2492

Pseudomonas aeruginosa PAO1 chromosome, complete genome.

imported from the CollecTF database

NCBI GenBank BacDive

Frequency Matrix

A 7 0 0 6 1 1 1 2 0 1 0 0 0 7 0 4 2 2 0 6 1 0 6 1
T 0 7 1 1 1 2 1 2 5 0 6 1 0 0 7 0 1 1 3 0 0 5 0 4
G 0 0 0 0 1 0 2 0 0 5 1 0 7 0 0 1 3 1 2 0 0 0 0 1
C 0 0 6 0 4 4 3 3 2 1 0 6 0 0 0 1 0 2 1 0 5 1 0 0
Consensus A T C A C C C C T G T C G A T A G M T A C T A T

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF103461 PA4881 operon
ATCACCCATGTCGATAGACACTAT
5477649 5477672 + 19846594
MF103462 PA4623 operon
ATTTCAAACGTCGATGAATACTAT
5184415 5184438 - 19846594
MF103463 PA1744 operon
ATCATTTCTGTCGATAGTTAATAG
1887620 1887643 - 19846594
MF103464 PA2759 operon
ATCAACCTTATCGATAAGTACCAT
3119787 3119810 - 19846594
MF103465 PA3229 operon
ATCACCGCCGTCGATCTCGACTAA
3616847 3616870 + 19846594
MF103466 PA4354 operon
ATCAGCCCTGTCGATAGCGACTAT
4881948 4881971 + 19846594
MF103467 mexE operon
ATCACTGTTCGTGAT
2808641 2808655 + 20727012