Details for MX000284

General Information

MX000284

PchR

PA4227

Pseudomonas aeruginosa PAO1 chromosome, complete genome.

imported from the CollecTF database

NCBI GenBank BacDive

Frequency Matrix

A 0 0 0 0 2 0 0 0 2 2 0 0 2 2 2 2 2 0 0 0 0 0 0 0 2 2 0 0 0 2 2 2
T 0 2 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0
G 0 0 2 0 0 2 0 2 0 0 0 2 0 0 0 0 0 2 0 0 0 0 2 0 0 0 0 0 2 0 0 0
C 2 0 0 2 0 0 2 0 0 0 0 0 0 0 0 0 0 0 2 2 2 2 0 2 0 0 0 2 0 0 0 0
Consensus C T G C A G C G A A T G A A A A A G C C C C G C A A T C G A A A

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF103472 pchD operon
CTGCAGCGAATGAAAAAGCCCCGCAATCGAAA
4742303 4742334 + 16194235
MF103473 pchD operon
CTGCAGCGAATGAAAAAGCCCCGCAATCGAAA
4742303 4742334 + 16194235