Details for MX000295

General Information

MX000295

SigF

CD630_07720

Clostridium difficile 630, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 5 5 4 6 4 0 4 8 1 9 8 9 6 5 5 3 6 3 5 5 10 6 6 1 0 1 2 5 9 9 6 8 7 2 4 6 5 7 10 0 6 1
T 5 5 3 4 6 1 7 3 10 2 2 1 3 5 3 2 2 8 3 4 1 5 4 8 4 1 7 2 2 2 4 0 4 9 4 3 4 2 1 9 2 0
G 1 0 0 0 0 10 0 0 0 0 0 1 0 0 1 1 1 0 2 2 0 0 0 1 4 9 2 0 0 0 0 0 0 0 2 0 1 2 0 0 1 1
C 0 1 4 1 1 0 0 0 0 0 1 0 1 1 2 5 2 0 1 0 0 0 1 1 1 0 0 4 0 0 1 3 0 0 1 2 1 0 0 0 0 0
Consensus W W M A T G T A T A A A A W A C A T A A A A A T K G T A A A A A A T W A A A A T A R

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF103610 spoIIQ operon
TAATTGTATAAAATGCCAAAAACACGTCAATAATCCAAATG
170587 170590 + 24098137
MF103611 CD630_03470 operon
TTCACGATTAAAAAACATAAATTGGTAAATACTATAAGATA
422757 422760 + 24098137
MF103612 gapN operon
GAAATGTTTACATAACGAATAAATGGCTATAATTTAAATA
693126 693129 + 24098137
MF103613 CD630_07610 operon
TTCATGTATATTATTTAACTATACTGTTTAAAATATTAATTG
932626 932629 + 24098137
MF103614 CD630_12290 operon
AAATAGTATTAGCCCCTTAGAAATTGTCAATAATGAAATTA
1427594 1427597 + 24098137
MF103615 tepA operon
TATCTTAATATATTTGATTTATTTGGTAAAACTAAATTA
1533371 1533374 + 24098137
MF103616 gpr operon
TTCTTGTTATAAAATACTAAATTTTGTTAACAATTATAATTA
2852330 2852333 - 24098137
MF103617 CD630_28560 operon
ATTTAGAATAAATCCATGAATATGAGAAAAAATAAGTATA
3339897 3339900 - 24098137
MF103618 spoIIR operon
ATTATGAATAAATTAAATTTAATTGGACATAATTGATGATA
4165994 4165997 - 24098137
MF103619 CD630_26860 operon
ACCAAGTATAAAAAATATTATAATTGTAAAACTTACAAA
3106296 3106299 - 24098137
MF103620 sigG operon
AAAAAGTATAAAAAAATTGGAAATGTAAATAATTTCAATA
3050598 3050601 - 24098137