Details for MX000296

General Information

MX000296

SigG

CD630_26420

Clostridium difficile 630, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 1 3 13 14 13 13 5 8 16 24 8 21 18 17 18 14 6 7 7 10 14 20 14 17 12 11 8 4 18 21 32 14 29 19 2 31 17 12 13 14 10 16 3 2 1 1 0 0 0 0 0 1 1
T 1 3 16 12 13 12 13 5 13 7 24 10 11 12 15 17 20 21 18 15 15 8 13 15 18 17 6 3 3 2 1 17 2 3 31 2 10 17 17 14 11 2 2 1 2 0 1 1 0 0 1 0 1
G 0 1 0 2 3 5 9 19 1 1 0 1 2 0 0 1 2 2 4 6 1 2 1 0 2 3 19 17 8 5 0 0 0 0 0 0 2 2 1 1 2 4 1 1 0 0 0 0 1 1 0 0 1
C 0 2 1 3 3 2 5 0 2 0 0 0 1 3 0 1 5 3 4 2 3 3 5 1 1 2 0 9 4 5 0 2 2 11 0 0 4 2 2 2 6 0 0 0 0 0 0 0 0 0 0 0 0
Consensus W W T A W A T G A A T A A A A T T T T T T A A A T T G G A A A T A A T A A T T W T A A A T A T T G G T A D

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF103621 CD630_06840 operon
AACATGTATATTTTTTCCATGAAAAATAAATAATAAAAAATA
830199 830202 - 24098137
MF103622 spoVAC operon
AATAGGTTTATTTTTTTAAAATTAACAAATAATACTTTA
944310 944313 + 24098137
MF103623 spoIVB operon
TAAATGAATAAATTCTCAGGAAAAAGGAATTATAAATACA
1411327 1411330 + 24098137
MF103624 CD630_12900 operon
ACCAATTATAACAATCTTTTATTAGTAAAAACTACTTA
1498505 1498508 + 24098137
MF103625 CD630_14630 operon
ATAACATAATTTTTATTAAAATAATACAGATACTATTTATA
1691573 1691576 + 24098137
MF103626 CD630_15430 operon
CAAAAGAATAGAATGGGTATATTTGTGAAATAATAATA
1792417 1792420 + 24098137
MF103627 CD630_15670 operon
ATTTGGAATAGTATTACAACTTAAGTAAATAATAATTTTG
1814356 1814359 + 24098137
MF103628 CD630_15680 operon
TAAGTGTATATCTATTTGTTTATTGCAAAACATATAATA
1815211 1815214 + 24098137
MF103629 CD630_18800 operon
ATTGTGTAAAGTGAGAATACTATTTTCTTATATTGGTAT
2186306 2186309 + 24098137
MF103630 CD630_21120 operon
ATTACAAATAAATATATGTACTTTGGGAAAAATAAATATAG
2441656 2441659 - 24098137
MF103631 CD630_22451 operon
CTTATGAATTTTATTTGTAAAATTGCTAAAACTATTACA
2599068 2599071 - 24098137
MF103632 CD630_23750 operon
TAAGTGTATAAAATTTAGATAACTTCACATAATAAGTTTA
2741419 2741422 + 24098137
MF103633 CD630_24650 operon
TAGACTAATATAAAAAAAAACTTTGGGAATACTAAAACCA
2846279 2846282 - 24098137
MF103634 sspA operon
TACCTGAATTAAAAATGTTTAAAATCACATAATATTATCA
3107629 3107632 - 24098137
MF103635 CD630_27620 operon
GTTTTGATTAATAATGTAATATTTTGATAATAATACCTATTG
3211281 3211284 - 24098137
MF103636 CD630_28080 operon
AAATTGTATAAAAACTTACAGCTTGGAGAAAATAATAGA
3278805 3278808 - 24098137
MF103637 CD630_28410 operon
ACAATGAATAGTATTTACTTCTTGGCAAACAATAATTA
3323998 3324001 - 24098137
MF103638 rbr operon
ATTGAGCATAATTATATCTCCTATTGGAATAATAAAT
3326853 3326856 + 24098137
MF103639 CD630_32201 operon
TATTTGTATAAATTTATTTTAATTGACAAAAATACAAATA
3769140 3769143 - 24098137
MF103640 sspB operon
TTTCTGTATATATTATTTTTATTTTGGAGAAATTAGTATTA
3804205 3804208 + 24098137
MF103641 CD630_34890 operon
TAATTGAATAATATATCTAAAAAAAGCCATCCTATTATT
4079467 4079470 - 24098137
MF103642 spoVT operon
TTTTTGTATATTTTTCTTAACAATGGTAAAAATAAACTTA
4088959 4088962 - 24098137
MF103643 CD630_35511 operon
AATACGTATTTCTTTTTTCATTTCGGGAAAACTAAACACA
4146872 4146875 - 24098137
MF103644 CD630_05430 operon
TATATGGATAAAAAACCCTAGAAACTCCAAATATAATAAGA
648017 648020 + 24098137
MF103645 dacF operon
ATTTAGAATAAAAAAAGTTAAATGTGAGAAAATAAGTTTAA
1498763 1498766 + 24098137
MF103646 CD630_13540 operon
ATTGATACAATTAATTTTTAATATTGGACATAATAAAATAG
1570480 1570483 + 24098137
MF103647 pdaA operon
ACTATAAATATTCAAACTATATTATAAGAAATATATTTTAAA
1658355 1658358 - 24098137
MF103648 CD630_17070 operon
TTTGCTAATAAAAAATTGTAAAAAGGGAAAACTTTAGTCA
1981442 1981445 + 24098137
MF103649 CD630_17890 operon
ACTTTGAATTAAATTTTTTATATAGGATATACTAACTAAGTG
2072033 2072036 - 24098137
MF103650 CD630_36100 operon
AAGGTGATTAAATTACATAAATAAAGGCTATAATAGTATGG
4217455 4217458 - 24098137
MF103651 CD630_26360 operon
GAAGGGAATTTTTTTTGTTTTTTGCACAAACTATATAA
3046122 3046125 - 24098137
MF103652 CD630_14860 operon
TTTTAGTAAATAAAATATAAAAATATAGAAATACTAAATTA
1721461 1721464 + 24098137
MF103653 CD630_28090 operon
TAATGGTTATATTCTTGTAATTATATGGACATAATTTATAATA
3278922 3278925 + 24098137