Details for MX000301

General Information

MX000301

LexA

sll1626

Synechocystis sp. PCC 6803, complete genome.

imported from the CollecTF database

NCBI

Frequency Matrix

A 1 1 0 1 1 0 1 0 0 0 1 0 1 1 0 0 0 1 0 0 1 1 0 0 1 0 0 0 1 0 1 0 0 0 4 2 2 1 1 0 1 0 0 1 0 0 0 0 3
T 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 1 0 0 1 2 0 0 1 0 1 4 0 0 1 1 2 1 1 4 2 1 0 3 1 0 0
G 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 2 0 0 0 0 0 1 0 1 0 0 0 0 1 0 0 0 0 0 1
C 0 0 1 0 0 1 0 1 1 1 0 0 0 0 1 1 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 2 3 0 0 1 1 1 1 3 2 0 0 1 3 0 0 1 0
Consensus A A C A A C A C C C A G A A C C T A G T A A C T A G T T M G W C C T A A A N T C C T T H C T T C A

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF103731 MYO_112040 operon
TAGTCCTAGAGTCCTA
1317826 1317841 - 14652736
MF103732 MYO_115360 operon
AACAACACCCAGAACCTAGTAACTAGTTCGACTTACCCTCCTTTCTTCG
1677676 1677724 - 16238629
MF103733 MYO_126190 operon
CTAATACTTTGACTA
2884916 2884930 + 18555801
MF103734 MYO_112040 operon
CTAAATACATTCCTA
1317814 1317828 - 18555801