Details for MX000302

General Information

MX000302

OxyR

RSP_2780

Rhodobacter sphaeroides 2.4.1 chromosome 2, complete sequence.

NCBI GenBank BacDive

Frequency Matrix

A 0 1 0 0 1 0 0 0 0 0 0 1 1 2 0 1 0 0 1 0 0 0 0 0 0 1 0 1 0 0 2 1 1 2
T 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 1 2 0 0 0 0 1 2 1 1 1 0 0 2 0 0 0 0 0
G 1 0 0 2 1 2 0 0 1 1 2 0 0 0 2 0 0 0 1 1 1 1 0 0 1 0 1 1 0 2 0 0 1 0
C 0 0 2 0 0 0 1 1 0 1 0 1 1 0 0 0 0 2 0 1 1 0 0 1 0 0 1 0 0 0 0 1 0 0
Consensus G A C G R G Y Y K S G M M A G W T C R S S K T Y K W S R T G A M R A

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF103735 RSP_3751 operon
CGGGTCGCGACAGATCACCTTTGAGATGAAGA
877092 877123 - 17351037
MF103736 RSP_3751 operon
GACGAGCTTGGCAAGTTCGGGGTCTTCGTGACAA
877005 877038 - 17351037