Details for MX000303

General Information

MX000303

XylR

BL03942

Bacillus licheniformis DSM 13 = ATCC 14580 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 1 3 4 1 1 0 2 2 1 1 2 4 3 0 1 2 0 0 2 2 2 0 4 4 4 2 2 1 0
T 0 1 0 0 2 2 0 0 3 3 2 0 1 4 0 0 3 3 1 2 1 1 0 0 0 0 2 3 3
G 3 0 0 3 1 1 2 2 0 0 0 0 0 0 3 2 1 0 0 0 1 0 0 0 0 0 0 0 0
C 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 3 0 0 0 2 0 0 1
Consensus G A A G T T R R T T W A A T G R T T A W A C A A A M W T T

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF103739 xylA operon
ctctatttccattgaaagcgattaattgatcctgtaaaatacatACAaggaa
3875977 3876028 - 1953294
MF103740 xylR operon
gaaatagaggaaaaaataagttttcaaaatttgttatactataaTaaatt
3876020 3876069 + 1953294
MF103741 xylA operon
gatcctgtaaaatacatacaaggaagttagtttaatggttaaacaaacattgttttttaacgtttgcaaggaaaagtgaagggggagat
3875913 3876001 - 7997167
MF103742 xylA operon
gaAGTTAGTTTAATGGTTAAACAAACAtt
3875951 3875979 - 7997167