Details for MX000304

General Information

MX000304

Pen

BL01642

Bacillus licheniformis DSM 13 = ATCC 14580 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 2 0 0 2 0 0 2 0 2 0 1 0 0 0 2 2 0 1 1 0 1 1 1 2 0 0
T 0 0 2 0 2 2 0 0 0 2 1 2 0 2 0 0 0 1 1 2 1 0 0 0 2 0
G 0 2 0 0 0 0 0 0 0 0 0 0 2 0 0 0 2 0 0 0 0 1 1 0 0 2
C 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Consensus A G T A T T A C A T W T G T A A G W W T W R R A T G

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF103743 blaP operon
AGTATTACATTTGTAAGTATAGGATG
376 401 + 3260234
MF103744 blaP operon
aatcttacaaatgtagtctttgaaagtattacatatgtaagatttaaatg
185 234 + 3260234