Details for MX000305

General Information

MX000305

ArgR

BL01911

Bacillus licheniformis DSM 13 = ATCC 14580 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 1 0 0 0 0 0 0 1 0 0 0 1 1 0 2 0 0 0 1 1 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 1 0 1 0 0 0 1 1 0 1
T 0 1 1 1 2 0 0 0 2 2 2 0 1 0 0 2 0 0 0 0 1 2 1 1 2 0 0 2 2 1 1 2 0 2 2 2 2 0 0 0 0 1 0 1 0 0 0 1 0 1 0 0 0 0
G 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 1 0 0 0 0 0
C 0 0 0 0 0 2 1 1 0 0 0 1 0 2 0 0 1 0 1 0 1 0 0 1 0 2 1 0 0 1 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 1 0
Consensus A T T T T C S M T T T M W C A T C G M R Y T W Y T C M T T Y Y T G T T T T A A G C T G T A C A T G T A A C A

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF103745 arcA operon
tcgctttcacatcgcgcttctccttcctgttttaagctgtacatgTaaca
3989718 3989767 + 9851988
MF103746 arcA operon
attttccatttatcataattattcatttttgtttt
3989638 3989672 + 9851988