Details for MX000306

General Information

MX000306

CcpA

BMD_4804

Bacillus megaterium DSM 319 chromosome, complete genome.

NCBI GenBank BacDive

Frequency Matrix

A 0 0 0 0 0 1 1 0 2 1 0 0 1 0 2 3 2 0 0 0 0 0 3 3 1 3 1 1 1 0 0 1 1 1 0 1 0 0 1 0 0 0 0 0 0 0 0 0
T 1 0 0 1 0 0 0 0 0 1 1 2 2 0 1 0 0 0 0 0 0 3 0 0 0 0 0 0 0 2 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 2 2 2
G 0 0 0 0 1 0 0 1 0 0 1 0 0 3 0 0 1 3 0 3 1 0 0 0 0 0 0 1 1 0 1 0 0 0 1 0 0 0 0 1 0 0 1 0 1 0 0 0
C 1 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 2 0 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 1 0 0 0 0
Consensus Y C C T G A A G A W K T T G A A A G C G C T A A C A M R R T G A A A G A T C A G C T G C G T T T

Sequence Logo

Motif List

Motif AccMotif NameBinding SequenceStartEndOrientationPubMed-ID
MF103747 xylB operon
tcattttgaaagcgcTaacaaagtttt
1855081 1855107 + 9102460
MF103748 xylB operon
ccctgaagaagtagtaggcggtaaaacgatgaaagatcagctgcgttt
1855156 1855203 + 12432959
MF103749 proY operon
tgaaagCGcTaaca
3809747 3809760 - 9102460